Studium, Ausbildung und Beruf
 StudiumHome   FAQFAQ   RegelnRegeln   SuchenSuchen    RegistrierenRegistrieren   LoginLogin

Start- und Stoppcodons bei der Proteinbiosynthese
Neues Thema eröffnen   Neue Antwort erstellen
Foren-Übersicht -> Biologie-Forum -> Start- und Stoppcodons bei der Proteinbiosynthese
 
Autor Nachricht
Schwarzes Smartie
Senior Member
Benutzer-Profile anzeigen
Senior Member


Anmeldungsdatum: 06.05.2006
Beiträge: 616
Wohnort: Paradise City a.k.a. Köln :)

BeitragVerfasst am: 12 Dez 2009 - 21:52:08    Titel: Start- und Stoppcodons bei der Proteinbiosynthese

Hallo Smile

Ich habe ein paar Fragen zur Proteinbiosynthese, die mir hoffentlich jemand beantwortet.

1.) zur Translation:
Woran erkennt die RNA-Polymerase, an welcher Stelle der DNA sie die Doppelhelix zu entwinden und aufzuspalten hat? Und wie kommt es, dass alle Gene abgeschrieben, nicht immer ein und dasselbe?
An einem Startcodon, oder? Dieses Startcodon wird nicht überschrieben, sondern erst der Abschnitt dahinter, oder? An einem Stoppcodon stoppt die Translation, also hat sie EIN Gen abschrieben. --> Ein Gen auf der m-RNA. Wieso sind dann auf der m-RNA immer noch ein Start- und ein Stoppcodon? Wenn eine m-RNA doch eh für ein Protein codiert Question

Dann hierzu die Frage: In welches Peptid wird folgender Abschnitt eines codogenen DNA-Strangs übersetzt?
3' CTGGCTACTGACCCGCTTCTTCTATC 5'
Da muss ich jetzt erst mal die m-RNA bestimmen. Und dazu brauch ich ein Startcodon ... ?
Wir haben dazu die Codesonne. Ist dieses Startcodon ATG? (Ich hab verstanden, dass ich von 5 nach 3 ablesen muss)

Und dann noch weitere Fragen, auf die ich mir überhaupt keinen Reim machen kann Sad :
1. Eine wichtige Anwendung der Gentechnik ist die Herstellung von Insulin durch "umprogrammierte" Bakterienzellen. Aus welchen Gründen reicht es nicht aus, das menschliche Insulingen in die Bakterien einzuschleusen?
2. Wieso kann man auch nicht menschliche Insulin-m-RNA in die Bakterien einschleusen um die Insulinproduktion in Gang zu bringen?

Hmmm... Sad

Für Hilfe wär ich jedenfalls dankbar
Tschüssi
DasAtom
Full Member
Benutzer-Profile anzeigen
Full Member


Anmeldungsdatum: 06.11.2007
Beiträge: 337
Wohnort: Hamburg

BeitragVerfasst am: 12 Dez 2009 - 22:35:00    Titel:

zu 1.)

da hast du einiges durcheinander gebracht. Zunächst musst du wissen, dass es die RNA-Polymerase nur bei der Transkription gibt. Dies beginnt nicht an einem Startcodon, sondern an einem Promotor. Das sind Proteine, die auf der DNA drauf sitzen und bestimmte Gene regulieren, sie sitzen aber nicht direkt vor dem Gen. Nachdem dann die DNA in hnRNA (oder prä-mRNA) transkribiert wurde und anschließend zu mRNA prozessiert wurde, kommt sie ins Zytoplasma, wo sie dann translatiert wird.

Die Translation wird ja durch Ribosomen eingeleitet. Diese beginnen die mRNA am 5'-Ende zu lesen und erst wenn sie auf das Startcodon AUG stoßen, beginnen sie das Protein zu synthetisieren.

vielleicht hilft dir dieses Video, ist zwar auf Englisch, aber ist ganz schön. Smile

Zu der Aufgabe mit dem Gen: richtig, du musst den komplementären Strang aufschreiben,der aber gegenläufig ist, also:

DNA: 3'---------------5'
RNA: 5'---------------3'

und dann musst du vom 5' ausgehend das Codon AUG suchen. (nicht vergessen: bei RNA ist T immer durch ein U ersetzt)

zum Insulin: es reicht nicht einfach das Gen in die Bakis einzuschleusen, da es nicht exprimiert werden würde, sondern eher tatenlos im Zytoplasma rumschwimmen würde. Du musst das Gen am besten vor einen starken bakteriellen Promotor einfügen, sodass das Gen auch in großer Menge transkribiert wird.
Einfach nur die mRNA einzuspeisen ist genauso sinnlos. Die mRNA wird zwar eine Zeit lang translatiert, doch irgendwann wird jede mRNA abgebaut und dann wird keine neue mehr gebildet, da es kein Gen dazu gibt.

ich hoffe es war einigermaßen verständlich

Gruß

DasAtom
p8003
Moderator
Benutzer-Profile anzeigen
Moderator


Anmeldungsdatum: 30.07.2006
Beiträge: 2488
Wohnort: München

BeitragVerfasst am: 12 Dez 2009 - 22:50:20    Titel:

DasAtom hat folgendes geschrieben:
es reicht nicht einfach das Gen in die Bakis einzuschleusen, da es nicht exprimiert werden würde, sondern eher tatenlos im Zytoplasma rumschwimmen würde.
Wenn überhaupt, viel wahrscheinlicher ist dass die Fremd-DNA durch das Bakterium einfach degradiert wird.
Schwarzes Smartie
Senior Member
Benutzer-Profile anzeigen
Senior Member


Anmeldungsdatum: 06.05.2006
Beiträge: 616
Wohnort: Paradise City a.k.a. Köln :)

BeitragVerfasst am: 13 Dez 2009 - 02:48:27    Titel:

Achso ist das bei Transkription: Es befinden sich auch Abschnitte auf der m-RNA, die nicht in Proteine translatiert werden... Sondern nur der Bereich zwischen dem Start- und dem Stoppcodon. Aaaach so Smile

Ist die m-RNA denn so aufgebaut?
5'Methyliertes Ende - AUG - BASENBASENBASEN - stoppcodon - Poly-A-Schwanz3' oder können zwischen dem stoppcodon und dem Poly-A-Schwanz noch Basen sein? (Wenn es so ist, wieso ist das nicht sinnlos?)

Kann ich bei der 1. Frage auch schreiben, dass die m-RNA ja prozessiert werden müsste und in Prokaryoten wird nichts prozessiert.
Hat das nicht auch was damit zu tun?
DasAtom
Full Member
Benutzer-Profile anzeigen
Full Member


Anmeldungsdatum: 06.11.2007
Beiträge: 337
Wohnort: Hamburg

BeitragVerfasst am: 13 Dez 2009 - 15:41:42    Titel:

Hier nochmal von Wikipedia die schematische Darstellung einer prozessierten mRNA. Hier siehst du auch, dass es vor und nach dem Gen noch Basen gibt, die nicht translatiert werden. Ich denke der Sinn vom 5'-UTR (untranslatierte Region) ist klar, da hier das Ribosomen (welches ja ziemlich groß ist) erst ansetzen muss, bevor es mit der eigentlichen Arbeit beginnen kann.

Bei 3'-Ende ist der Sinn (verständlicherweise) nicht so offensichtlich. Der Poly-A-Schwanz hat hierbei die Rolle die Halbwertszeit der mRNA zu bestimmen, da ständig etwas von dem Schwanz enzymatisch abgebaut wird und wenn dann die codierende RNA selbst abgebaut wird, ist das Protein ja nicht mehr vollständig. Die 3'-UTR hat hingegen den Sinn, dass hier bestimmte regulatorische Proteine ansetzen, welche die Menge der produzierten Proteine entweder erhöht oder verringert, da diese regulatorischen Proteine die Ribosomen z.B. stimulieren oder hemmen können.

Zu dem Insulin: stimmt natürlich, dass es in den eukaryontischen Genen noch die Introns gibt (Merksatz: die Introns sind nicht "interessant", also nicht proteinogen Laughing), jedoch gibt es die Möglichkeit gentechnisch die DNA so zu verändern, dass sie nur noch aus Exons besteht, bevor man sie in die Bakis transformiert. Dennoch keine blöde Idee Wink

Gruß

DasAtom
Beiträge der letzten Zeit anzeigen:   
Foren-Übersicht -> Biologie-Forum -> Start- und Stoppcodons bei der Proteinbiosynthese
Neues Thema eröffnen   Neue Antwort erstellen Alle Zeiten sind GMT + 1 Stunde
Seite 1 von 1

 
Gehe zu:  
Du kannst keine Beiträge in dieses Forum schreiben.
Du kannst auf Beiträge in diesem Forum nicht antworten.
Du kannst deine Beiträge in diesem Forum nicht bearbeiten.
Du kannst deine Beiträge in diesem Forum nicht löschen.
Du kannst an Umfragen in diesem Forum nicht mitmachen.

Chat :: Nachrichten:: Lexikon :: Bücher :: Impressum